The cDNA obtained was incubated with Taq DNA Polymerase (2.5 U), 3′- and 5′-specific primers (0.4 μM), and a dNTP mix (200 μM) in a thermophilic DNA polymerase buffer that contained MgCl2 (1.5 mM). The primer sequences used were described by Cardell et al.

(2008): TNFR1: Forward primer CGATAAAGCCACACCCACAAC Reverse primer GAGACCTTTGCCCACTTTTCAC TNFR2: Forward primer GAGACACTGCAGAGCCATGAGA Reverse primer CAGGCCACTTTGACTGCAATC Full-size table Table options View in workspace Download as CSV Tracheal TNFR1 and TNFR2 protein selleck screening library expression was quantified by Western blot. Briefly, tracheal tissue proteins were extracted in Tris buffer (50 mM, pH 7.4) containing leupeptin (10 μg/ml), soybean trypsin inhibitor (10 μg/ml), aprotinin (2 μg/ml) and PMSF (1 mM). Homogenate proteins (87.5 μg) were separated by sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS–PAGE; 12%) according to Laemmli (1970) and were electrophoretically transferred to a nitrocellulose membrane. After blocking nonspecific sites with 5% non-fat milk, membranes were incubated overnight with the primary rabbit polyclonal

antibody raised against learn more TNF receptor-1 or rabbit polyclonal anti-TNF receptor-2 (500 ng/ml). Membranes were washed with Tris-buffered saline containing 0.1% Tween-20 and incubated with horseradish peroxidase-conjugated goat anti-rabbit secondary antibody. A chemiluminescent assay (HRP SuperSignalWestPico; Pierce, USA) was used to detect immunoreactive bands. The intensities of the bands were estimated by densitometry analysis and were compared to the intensity of β-actin expression. The mean and standard error of the mean (SEM) were analysed using the Student’s tailed paired or unpaired t test or ANOVA followed by Tukey’s test. GraphPad Prism 5.0 software (San Diego, CA, USA) was used and P < 0.05 was considered significant. Intact tracheal segments obtained from HQ-exposed animals showed hyperresponsiveness to MCh (Fig. 1). However, following mechanical removal of the epithelium, responsiveness returned to control levels (Fig. 2A). According to histological analysis, rubbing the lumen

of the tracheal rings was effective at removing the epithelium (Fig. 2B). It has previously been established that infiltrating neutrophils increase the responsiveness VDA chemical of tracheal muscle to parasympathetic stimulation (Bethel et al., 1992). Data presented in Fig. 3 show that HQ exposure for 5 days did not induce neutrophil influx into the tracheal tissue, suggesting that the HQ-induced tracheal hyperresponsiveness to MCh was not dependent on infiltrated neutrophils. As NO produced by constitutive nitric oxide synthases prevents MCh-induced smooth muscle contraction (Meurs et al., 2000), we investigated whether HQ exposure could impair gas production. Equivalent levels of NO2− were detected in the HQ (6.3 ± 0.4 μM/mg tissue) and vehicle (5.6 ± 0.