236, 95%CI: 1.044 – 9.428, adj p = 0.015] (Table 2). Another factor that affected the abundance of stool microbiota was the age of weaning to semisolids. Linear mixed model showed a decrease in abundance of Clostridium Tanespimycin leptum group for every month of increase in weaning age [B: -0.827, 95%CI: -1.5934 - -0.0602, adj p = 0.035]. Table 2 Feeding habits and demographic factors affecting the relative abundance of microbial groups   Bacteria groups Mean differences (95% CI) p value Total breastfeeding: Yes versus No Lactobacilli – Enterococci 5.236 (1.044 – 9.428) 0.015 Weaning age Clostridium leptum -0.827 (-1.5934 – -0.0602) 0.035 Sibling number Bifidobacterium Enterobacteriaceae 3.873 (0.112 -7.634)

-0.526 (-0.8725 – -0.1801) 0.044 0.004 Linear mixed model analysis adjusted with confounding factors (Location, mode of delivery, weaning age, sibling number, total breastfeeding up to 6 month, eczema and prenatal antibiotics). Only bacteria learn more groups with statistically significant differences are listed. (D) Sibship Size Relative abundance of Bifidobacterium increased by 3.873% with every increase in sibling number [B: 3.873, 95%CI: 0.112 -7.634, adj p = 0.044]. On the other

hand, the abundance of Enterobacteriaceae decreased with each increase in sibship size [B: -0.526, 95%CI: -0.8725 selleck products - -0.1801, adj p = 0.004] (Table 2). (E) Exposure to Antibiotics The relative abundance of Clostridium leptum group at 1 year of age was significantly higher for infants that reported their postnatal antibiotic intake at period of 6 months to 1 year of age [B: 5.706; adj p = 0.025], as compared to the infants

who did not consume antibiotics. Stool Microbial Richness/Diversity T-RFs of stool microbiota in SG and IN cohorts were obtained from three individual enzymatic digestions (i.e., AluI, MspI and RsaI), and compared for their microbial richness based on Shannon and Simpson Index. Microbial richness between the cohorts was considered different when both Shannon and Simpson Index from all three enzymatic digestions were significantly different. Morin Hydrate Table 3 shows that there were no observable differences in the microbial richness of SG and IN cohorts at both 3 months and 12 months of age, both before and after adjusting for demographic confounders. In contrast, when the infants from both geographical locations were grouped according to their mode of delivery, microbial richness of stool microbiota in vaginal-delivered infants had a significantly higher microbial richness compared to caesarean-delivered infants at 12 months of age (Table 3). The microbial richness of stool microbiota did not correlate with other lifestyle factors. Table 3 Shannon and Simpson diversity index determined from T-RFLP profiles Time Index of diversity Location Mode of delivery       Indonesia (n = 19) Singapore (n = 29) Vaginal (n = 32) Caesarean (n = 16) 3 month Shannon AluI mean (SD) 1.648 (0.658)* 1.

Finally, cells were resuspended in 0.6 mL of buffer. At least 10,000 cells were analyzed per sample on the FACScaliber machine (BD Biosciences, San Jose, CA, USA). Additionally, ΔΨm was also observed by fluorescence microscopy. Briefly, untreated and treated cells were cultured in 6-well plates, stained with 1.0 mL of JC-1 working SHP099 purchase solution at 37°C for 20 min, washed twice with JC-1 staining 1 × buffer, and then observed using a fluorescence microscope at 200× (Olympus, Japan). 2.6 Statistical analysis Results were analyzed using SPSS software 13.0 and compared using

one-way analysis of variance (ANOVA). Data were presented as mean ± standard deviation (SD) of three independent experiments. P < 0.05 was considered statistically significant 3. Results 3.1 Ad-bFGF-siRNA reduces STAT3 phosphorylation at Ser727 and Tyr705 in a time-dependent manner in U251 cells First, check details to investigate whether STAT3 and upstream kinases JAK1/2 are activated in U251 cells, we performed western blot and showed a higher expression of pSTAT3 Selleckchem IWP-2 Tyr705 and pJAK2 in the glioblastoma cell line U251 than in NHA (Figure 1A). The level of pJAK1 was not

significantly elevated in U251 cells (data not shown). Figure 1 Ad-bFGF-siRNA reduces STAT3 phosphorylation in U251 cells. (A) Western blot analysis revealed that the levels of pSTAT3 (Tyr705) and pJAK2 are higher in U251 cells than in normal human astrocytes (NHA). (B) Ad-bFGF-siRNA

(MOI = 100) reduces STAT3 phosphorylation (both Tyr705 and Ser727) in a time-dependent manner in U251 cells. Total STAT3 expression remains stable. Next, we knocked down bFGF using Ad-bFGF-siRNA, and the decrease in bFGF protein levels was confirmed by western blot (Figure 1B). Then, we examined Phospholipase D1 whether Ad-bFGF-siRNA treatment affects STAT3 phosphorylation. STAT3 is fully activated when both of its two conserved amino acid residues Tyr705 and Ser727 are phosphorylated [16]. For this propose, we extracted total proteins from DMSO, Ad-GFP, and Ad-bFGF-siRNA treatment groups at 24, 48, and 72 h time points and examined the levels of total and phosphorylated STAT3 by western blot. The total STAT3 expression remained similar among three groups across different time points (Figure 1B). Interestingly, the expression of pSTAT3 Ser727 moderately decreased at 24 and 48 h and then restored to the control level at 72 h. Furthermore, compared with the levels under the control and Ad-GFP treatment, the level of pSTAT3 Tyr705 under Ad-bFGF-siRNA treatment was markedly decreased at all three time points, even to an undetectable level at 48 h point. Thus, these findings suggested that Ad-bFGF-siRNA interferes with the activation of STAT3 in a time-dependent manner and this decrease in pSTAT3 could not be explained by a constitutional decrease in total STAT3. 3.

Clays are one of the most common suspended materials present in aquatic systems [24]. Reduced phytoplankton production and increased growth of heterotrophic bacteria in aquatic systems have often been attributed to high clay turbidity levels and low light transmission levels [24, 25]. I BET 762 In relation to solar disinfection, highly turbid water samples at 300 Nephelometric Turbidity Units (NTU), showed reduced microbial inactivation compared to less turbid or non-turbid

samples, which may be due to shielding of microbes from sunlight by suspended materials [26]. In batch system solar disinfection, Joyce et al. found that, less than 1% of the total solar UV light would reach a depth of 2 cm in water with a turbidity of 200 NTU [27]. Therefore, EAWAG, the Swiss Federal Institute of Aquatic Sciences and Technology, recommended that water for solar disinfection batch systems need to be not more than 10 cm in depth and a turbidity level of not more than 30 NTU [28]. Rincon and Pulgarin observed that water turbidity negatively affected the photocatalytic inactivation of microbes and resulted in bacterial re-growth, supported by nutrients associated with the suspended particles [29]. They also stated that suspended particles absorb heat from sunlight and warm the selleck chemical water. Warmer

water holds less oxygen and consequently affects microbial respiration and photocatalysis. Suspended particles also reduce light

penetration capacity by their scattering effect. One recent research study used a batch sequential CPC reactor to eliminate water pathogens, with reduced exposure time and minimal user input compared to other systemsn [30]. However, most of the previous studies of turbidity in solar disinfection have been in batch reactors with TiO2 suspensions, rather than immobilized systems. Another recent investigation has developed a CFD (computational fluid this website dynamics) model for water disinfection through a CPC pilot-plant reactor [31]. However, no laboratory experiments were evaluated in that study to evaluate its practical efficiency. In contrast to batch reactors and CPC reactor systems, the TFFBR system evaluated in the present study is a single-pass oxyclozanide system. The reaction on the surface of the TFFBR reactor is different, as water is not in a static condition. Therefore, this study reports for the first time the use of a single-pass flow-through TFFBR system to investigate the elimination of an aquaculture pathogen from water of different turbidities. Suspended particles are not the only obstacle to light penetration; dissolved coloured materials also absorb sunlight of different wavelengths [32]. Natural organic matter is present in all surface water; humic acids are major component in natural waters which are brown in colour [28].

As you will see below, my path crossed, although tangentially, his once more. On the photochemical differences in mesophyll and bundle sheath cells of C4 plants (by Gerry Edwards) Early in the studies on C4 plants, Berger Mayne made significant contributions to the understanding of photochemistry in the two photosynthetic cell types, mesophyll and bundle sheath, which are required for the functioning of C4 plants; see Raghavendra and Sage (2011) for a book on C4 photosynthesis. In the 1960s, biochemist Clanton Black (1931–2011; see a minireview by Black and Osmond 2005) and an agronomist

Harold VEGFR inhibitor Brown at the University of Georgia had an interest in knowing differences in the efficiency of photosynthesis in crops and weedy species. They published a paper in Weed CP673451 order Science on the competitive ability of plants with respect to photosynthesis, based on reported differences in physiological buy AZD5582 features and emerging information on plants having a C4 cycle (Black et al. 1969). Clanton

Black then teamed up with Berger at the Charles F. Kettering Research Laboratory (see Vernon 2003, for the history and the people and their research in this Lab). They published a paper in Plant Physiology in 1970 showing that leaves of several C4 species have a higher ratio of the reaction center of PSI (P700) to chlorophyll (Chl), and a higher Chl a/b ratio, than the C3 species (Black and Mayne 1970). They suggested that cyclic photophosphorylation should be quite active to support the high

photosynthetic capacity of C4 plants, and to meet the additional ATP requirement in C4 photosynthesis. During postdoctoral studies with Clanton Black, I developed a method to mechanically separate intact mesophyll cells from bundle sheath cells of the weedy species Digitaria sanguinalis, and joined Berger to also characterize LY294002 photochemical features of these chloroplasts (Mayne et al. 1971a); this work was also presented in the memorable Symposium on Photosynthesis and Photorespiration at the Australian National University, Canberra, Australia, in 1970 (Mayne et al. 1971b). Taking Berger’s lead, Bazzaz and Govindjee (1973) extended this work by studying several photochemical and spectral properties of maize (Zea mays) bundle sheath and mesophyll chloroplasts, focusing on the different spectral forms of Chl and their orientation, differences in variable to constant Chl fluorescence, and in the yield of Chl fluorescence. Bundle-sheath chloroplasts contained, relative to short wavelength absorbing Chl a forms, more long wavelength Chl a forms (Chl a 693 and Chl a 705) and less Chl b. Although the entire electron transport chain was present in both types of chloroplasts, there were other differences confirming Mayne’s excellent work.

Considering that those fragments may contain part of the additional IS copies plus their surrounding sequences, we cloned and sequenced the 3.3 kb and 2.5 kb DNA amplicons of B12 and B16, respectively, and designed flanking primers (Table

2) to confirm the position of the new IS copy. As predicted for the insertion of complete IS711 copies of 842 bp in length, specific PCR products of 1077 bp (B12) and 1142 bp (B16) were amplified (STA-9090 cell line Figure 2C and 2D). We believe that an IS replicative transposition is the most plausible explanation for these results. In fact, the sequence analysis suggested that transposition had occurred by a canonical TA duplication at YTAR site (R, purine; Y, pirimidine). In strain B12, this site was in an

intergenic region between a lactate permease gene (lldP) and BruAb1_0736 (hypothetical protein) (Figure 3, upper panel) corresponding to a 103 bp Bru-RS1 element, a palindromic repeat sequence AZD1480 mw that represents a putative insertion site for IS711 [14]. In contrast, the IS711 extra copy in B16, B49 and B50 was interrupting an ORF encoding a transcriptional regulator of the MarR family (BruAb2_0461, Figure 3 lower panel). Similarity searches showed that the B12 and B16 sites did not match with any of the IS711 loci previously reported for B. abortus or even with the novel IS711 sites recently described for Brucella marine check details mammal strains [6], although the B16 site was found in B. ovis. To confirm these findings and to investigate whether these sites were also present in the genomes (not available in databases) of the Brucella species carrying a high-copy number of IS711, we carried out PCR assays with B. ovis, B. ceti and B. pinnipedialis DNAs. For the B12-specific IS711, PCR amplifications with flanking primers yielded an IS-empty locus fragment (not shown). In contrast, the PCR amplifying Montelukast Sodium the B16 fragment yielded the predicted 1142 bp fragment in B. ovis but not in B. ceti or B. pinnipedialis (Additional file 1). Table 2 Primers used in this work Name Sequence (5′-3′) Reference 711d CATATGATGGGACCAAACACCTAGGG [19] 711u CACAAGACTGCGTTGCCGACAGA [19] RB51

CCCCGGAAGATATGCTTCGATCC [12] IS711out CAAGTTGAAACGCTATCGTCGC This work P5 CGGCCCCGGT [20] BruAb1_0736F TTGGTTTCCTTGCGACAGAT This work BruAb1_0737R AACCTTGCCTTTAGTTGCTCA This work BruAb2_0461F ATCAGGCTTTGCTGGCAATC This work BruAb2_0461R TCGTTTGCCATCTTGTTCAG This work marR-F1 GACGTGGTGGAGGAAACCTA This work marR-R2 ACTCGGCCAAACCTGATAA This work marR-F3 TTATCAGGTTTTGGCCGAGTCACATTGGAGTTGACCATCG This work marR-R4 CGCTTCGTGGTACGCTATTT This work Figure 2 PCR identification and characterization of new IS 711 insertion sites in B. abortus B12 and B16 field isolates. IS711-anchored PCR with: (A), primers IS711out-P5; or (B), RB51-P5. Site-specific PCR with: (C), primers BruAb1_0736F and BruAb1_0737R; or (D), forward and reverse primers of BruAb2_0461. For each lane, the number refers to the B. abortus strain used in the amplification.

The serum levels of IGF-I were significantly and sequentially reduced from controls to MGUS and from MGUS to MM. The significances see more between these three find more groups were always < 0.0001. In addition, these significances were more pronounced than those observed for bFGF and VEGF. A multivariate logistic regression analysis showed that the significances observed for

IGF-I concentrations in the three groups were independent of age and gender and the relative p was 0.01. Table 2 Serum levels of IGF-I, betaFGF and VEGF in Control, MGUS and MM Group N° IGF-I ng/ml B-FGF pg/ml VEGF pg/ml Controls 55 135.5 (65–279) 1.62 (1.04–2.15) 1.25 (0.15–1.95) MGUS 71 111.3 (10–215.8) 2.08 (0.04–8.19) 1.12 (0.15–5.90) MM 77 78 (16–352) 2.37 (0.04–82.7) 1.37 (0.3–18.3) P1   <.0001 0.01 0.19 P2 -- <.0001 .001 .57 P3 -- <.0001 .27 .14 P4 -- <.0001 .02 .14 A statistical analysis has been performed both on the three groups together and on the different couple of groups. Cytokine levels are given as median (range). P1 = univariate analysis, Kruskall-Wallis test on the three groups. P2 = univariate analysis, Mann Whitney

test on Controls vs MGUS. P3 = univariate analysis, Mann Whitney test on MGUS vs MM. P4 = univariate analysis, Mann Whitney test on Controls vs MM. The IGF-I behaviour has been also confirmed by logistic regression Selleck Sepantronium analysis after data correction for age and gender, as described in the text. Also bFGF presented significantly different serum values among the three groups. In particular, there was a statistically significant difference (p = 0.001) between the controls and the MGUS patients,

in which higher values were observed. A similar difference was registered between the controls and the MM patients (p = 0.02), while, in contrast, MGUS and MM showed similar results (p = 0.27). The multivariate analysis, corrected for age and gender, did not reach a statistical significance (p = 0.9). VEGF, finally, did not show significant variations in the four comparisons (p at least > 0.14) and the multivariate analysis, performed as above, was also not significant (p = 0.08). A correlation matrix using much the values of the four variables in MGUS or MM groups only resulted significant for VEGF vs b FGF (r = 0.37, p = 0.002) in MGUS patients. K- ras mutations in the MGUS and MM patients Since it is known that gene alterations may be linked with cytokine modulation, we analyzed the incidence (%) of K- ras mutations in MGUS and MM subjects, due to the emerging role of this gene in plasma cell dyscrasia pathogenesis [29, 30]. Mutations at K- ras codon 12 were analyzed on genomic DNA isolated from bone marrow cell specimens of the two groups of patients.

Kovalenko (1999) placed these species in Gliophorus. There is a disagreement in ITS sequences between Boertmann’s Danish and other Scandinavian collections deposited at O versus ARRY-438162 collections from the UK deposited at Kew with regard to determinations as C. citrinopallida

and C. xanthochroa (they are reversed); here we use sequences of the Kew collections for reference as their determinations were verified by matching to sequences of the types and to facilitate comparisons with Dentinger et al. (unpublished). The Scandinavian collections were renamed by matching them to the Kew reference sequences. Boertmann has examined the Kew collections and agrees with their determinations, so the Selleckchem SB202190 characters used to distinguish these two species need to be re-examined as they may not be reliable across the entire geographic range. Chromosera subg. Subomphalia Vizzini, Lodge & Padamsee, subg. nov. MycoBank MB804071. Type species: Chromosera viola (J. Geesink & Bas) Vizzini & Ercole, Micol. Veget. Medit. 26(2): 97 (2012) [2011]. ≡ Selleck MEK inhibitor Hygrocybe viola J. Geesink & Bas, in Arnolds, Persoonia 12(4):

478 (1985a), ≡ Cuphophyllus viola (J. Geesink & Bas) Bon, Doc. Mycol. 19(76): 73 (1989). Omphalioid, pileus indented in center, basidiomes purple or lilac, yellow pigments absent; surfaces dry; dextrinoid reactions absent from all context tissues; clamp connections rare in the trama, some medallion clamps present at base of basidia; basidiospores hyaline, thin-walled, inamyloid, not cyanophilic, broad, Q 1.0-1.9 (mean Q 1.5), not constricted; basidia short relative to the length of the basidiospores (ratio 3.6-5); lamellar context heterogeneous with a central, subregular strand composed of short, highly inflated elements,

flanked by lateral strata with highly interwoven slender hyphae. Terrestrial, often among mosses, not in Ribonucleotide reductase arctic-alpine habitats. Differing from subg. Chromosera in dry basidiome surfaces; absence of yellow pigments, extracellular pigment bodies in the pileipellis and dextrinoid reactions in tramal tissues; presence of a heterogeneous lamellar trama; and a terricolous (possibly moss-associated) rather than lignicolous habit. Differing from subg. Oreocybe in dry rather than viscid surfaces, absence of yellow pigments, absence of extracellular pigment bodies in the pileipellis, presence of a heterogeneous rather than interwoven lamellar trama, and broad non-constricted basidiospores. Differing from Gloioxanthomyces in dry rather than viscid surfaces, absence of gelatinization of the lamellar edge, absence of yellow pigments, and presence of a heterogeneous rather than interwoven lamellar trama. Phylogenetic support Subg. Subomphalia appears on a basal branch that is long relative to others in the Chromosera clade. The branch placing the monotypic species, C. viola, as sister to subgenera Oreocybe and Chromosera has strong support: 96 % MLBS and 1.

Primary or secondary amyloidosis is commonly associated with dysmotility disorders of the large and small bowel and cases of diverticular disease have been described [13–15]. Despite small bowel diverticulosis seems to be acquired, two cases of familiar predisposition have been reported [16, 17]. The incidence of jejunoileal diverticula in studies of the small bowel by enteroclysis is 2-2.3% which is comparable to autopsy data presenting an incidence of 1.3-4.6% for diverticula of the jejunum and ileum [18–20]. The jejunoileal

diverticulosis is usually multiple, more frequently located in the jejunum and in the terminal ileum and probably due to the larger size of the vasa recta at these areas [20]. Eighty percent of diverticula occur in the jejunum, fifteen percent BI 2536 research buy in the ileum and five percent in both [1]. Isolated jejunal diverticulosis

coexists with diverticula of the esophagous (2%), of the duonenum (26%) and of the colon (35%) [21]. The prevalence increases with the age and the disease presents a peak incidence at the sixth and seventh decades with a male predominance [22]. The size of small bowel diverticula varies. Diverticula may measure from few millimeters up to more than 3 cm. Performing a web search of the relative literature for giant jejunal diverticula and using terms such as ‘giant jejunal divericula’, ‘giant jejunal diverticulosis’ and ‘giant jejunoileal diverticulosis’, we found a limited number of cases Torin 1 clinical trial defined from the author’s LOXO-101 ic50 description as giant; one case associated with Ehlers-Danlos Syndrome and malabsorption [8], one associated with iron deficiency [23], two cases with diverticultis [24, 25], one presented with intestinal obstruction [26] and one manifested with intestinal

bleeding [title only] [27]. The problem in our research was the fact that in many case reports as well as in larger series, CYTH4 there was no objective measurement of the size of the diverticulum (intraoperative or pathological). In many reports, the description of the diverticula was based on no medical terms (egg, golf ball etc) or it was not reported at all [28, 29]. Liu et al. [30] in a series of 27 patients reported jejunoileal diverticula greater than 3 cm in 12 cases not specifying the precise size of the reported diverticula. Despite this problem, we identified a giant divericula measuring about 26 cm in a young patient with peritonitis [abstract only] [31]. The disease is usually silent. Nevertheless, Rodrigez et al. [21] reviewed the literature and noted symptoms in 29% of the cases. Many symptoms may be misdiagnosed as dyspepsia or irritable small bowel. Edwards described a symptom triad observed in these patients as ‘flattulent dyspepsia’ (epigastric pain, abdominal discomfort, flatulence one or two hours after meals) [32].

A 0.8 μl aliquot of each peptide mixture was deposited onto a 386-well OptiTOF™ Plate (Applied Biosystems, Framingham, MA, USA) and allowed to dry at room temperature. A 0.8 μl aliquot of matrix solution (3 mg/mL CHCA in MALDI solution) was then added onto dried digest and allowed to dry at room temperature. MALDI peptide mass fingerprinting, MS/MS analysis

and database searching For MALDI-TOF/TOF analysis, samples were automatically acquired in an ABi 4800 MALDI TOF/TOF mass spectrometer (Applied Biosystems, Framingham, MA, USA) in positive ion reflector mode (ion acceleration voltage was 25 kV for MS acquisition and 1 kV for MSMS) and the spectra were stored into click here the ABi 4000 Series Explorer Spot Set Manager. PMF and MSMS fragment ion spectra were smoothed and corrected to zero baseline using routines embedded in ABi 4000 Series Explorer Software v3.6. Each PMF spectrum was internally calibrated with the mass signals of trypsin autolysis ions to reach a typical mass measurement accuracy of <25 ppm. Known Batimastat in vitro trypsin and keratin mass signals, as well as potential sodium and potassium adducts (+21 Da and +39 Da) were removed from the peak list. To submit the combined PMF and MS/MS data to MASCOT software v.2.1 (Matrix Science, London, UK), GPS Explorer v4.9 was used, searching in the non-redundant

NCBI protein database. LC-ESI MS/MS analysis In some specific cases, alternative proteomic techniques were employed to confirm and improve protein identifications. For this purpose, we made use of liquid chromatography coupled to electrospray ion-trap mass spectrometry tandem MS (LC ESI-MS/MS). This was done using an Ultimate 3000 nano LC (Dionex, Amsterdam, Astemizole The Netherland) and a 75 micrometer I.D, 100 mm reversed-phase column, at a 300 nL/min flow, coupled to a Bruker HCT Ultra ion-trap mass spectrometer (Bruker Daltonics, Bremen,

Germany) working in dynamic exclusion mode. Database Search For protein identification, LC ESI MS/MS spectra were transferred to BioTools 2.0 interface (Bruker Daltonics) to search in the NCBInr database using a licensed version of Mascot v.2.2.04 search engine (http://​www.​matrixscience.​com; Matrix Science, London, UK). Search parameters were set as follows: carbamidomethyl cystein as fixed modification by the treatment with iodoacetamide, oxidized methionines as variable modification, peptide mass tolerance of 0.5 Da for the parental mass and fragment masses and 1 missed cleavage site. In all protein identifications, the probability Mowse scores were greater than the minimum score fixed as significant with a p-value minor than 0.05. Selected proteins were based on that who exhibited higher Mascot score and sequence coverage. A total of thirty-three different proteins showing differential expression pattern between polyP+ and polyP- this website strains (three independent replicates) were selected.

For example, the electrical conductivity rose from 21 to 54 S/cm with a density increase from 0.25 to 0.65 g/cm3. Significantly, we observed that the taller the forest used in the buckypaper fabrication,

the higher the electrical conductivity. Comparing buckypapers with almost the same density, the buckypaper obtained from forests with heights of 1,500 μm exhibited approximately twice the electrical conductivity of buckypaper made from 350-μm forests, (i.e., 45 vs. 19 S/cm at 0.50 g/cm3, and 27 vs. 16 S/cm around 0.35 g/cm3). Figure 2 Electrical conductivity of buckypapers EPZ5676 price (a) and sheet resistance of SWCNT forest (b). (a) The electrical conductivity of buckypapers as a function of the mass density of buckypapers. Red, black, and blue dots indicate the buckypaper fabricated from SWCNT forest with the heights of 1,500, 700, and 350 μm, respectively. (b) Sheet resistance

of SWCNT forest with different heights measured by a micro 4-probe. Red, black, and blue dots indicate the SWCNT forest with the heights of 1,500, 700, and 350 μm, respectively. Inset shows the photograph of the gold electrode BIBW2992 concentration on Si substrate used as a micro 4-probe. In order to verify that this apparent height-dependent variation in buckypaper conductivity was not due to differences in CNT quality, which has been shown to be essential for the various properties of buckypaper in previous works [34], Raman spectroscopy and electrical resistivity measurements of the as-grown SWCNT forests were carried out. The intensity ratios of the G-band (1,600/cm) and the D-band (1,350/cm) in the Raman spectra (see additional file 1: Figure S2), an indicator of CNT quality, were very similar (approximately 7). Peak positions and intensities in the radial breathing modes (RBM; 100 to 300/cm) were also nearly identical for all SWCNT forest heights. As the RBM peak position w (cm-1) is reported to be inversely proportional to the SWCNT diameter (nm), i.e., w = 248/d[35], these findings indicate that the effect of forest

height on SWCNT diameter distribution was small. Furthermore, electrical conductivity of raw material forest was evaluated by applying a micro 4-probe onto the sides of SWCNT forests. Since the distances between the probes (50 μm) in a micro 4-probe was sufficiently short compared Thymidine kinase with the forest height, CNT length had almost no influence on the resistance values observed with this measurement. The measured resistance was nearly identical (206 to 220 Ω/sq) regardless of forest height (Figure 2b), indicating that quality of the SWCNTs did not degrade when selleck chemical growing forests of height to 1,500 μm, in accordance with the results of Raman spectroscopy. As shown in the previous paragraph, taking into consideration the fact that forest height did not influence CNT quality, we conclude that the increase in buckypaper conductivity accompanying forest height was a result of the increased length of individual SWCNTs.